Bio::SeqFeature::Amplicon(3) Amplicon feature

SYNOPSIS


# Amplicon with explicit sequence
use Bio::SeqFeature::Amplicon;
my $amplicon = Bio::SeqFeature::Amplicon->new(
-seq => $seq_object,
-fwd_primer => $primer_object_1,
-rev_primer => $primer_object_2,
);
# Amplicon with implicit sequence
use Bio::Seq;
my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
$amplicon = Bio::SeqFeature::Amplicon->new(
-start => 6,
-end => 15,
);
$template->add_SeqFeature($amplicon);
print "Amplicon start : ".$amplicon->start."\n";
print "Amplicon end : ".$amplicon->end."\n";
print "Amplicon sequence: ".$amplicon->seq->seq."\n";
# Amplicon sequence should be 'CCCCCGGGGG'

DESCRIPTION

Bio::SeqFeature::Amplicon extends Bio::SeqFeature::Subseq to represent an amplicon sequence and optional primer sequences.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. 

  [email protected]                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

[email protected]

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: 

  https://github.com/bioperl/bioperl-live/issues

AUTHOR

Florent Angly <[email protected]>

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

 Title   : new()
 Usage   : my $amplicon = Bio::SeqFeature::Amplicon( -seq => $seq_object );
 Function: Instantiate a new Bio::SeqFeature::Amplicon object
 Args    : -seq        , the sequence object or sequence string of the amplicon (optional)
           -fwd_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
           -rev_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
 Returns : A Bio::SeqFeature::Amplicon object

fwd_primer

 Title   : fwd_primer
 Usage   : my $primer = $feat->fwd_primer();
 Function: Get or set the forward primer. When setting it, the primary tag
           'fwd_primer' is added to the primer and its start, stop and strand
           attributes are set if needed, assuming that the forward primer is
           at the beginning of the amplicon and the reverse primer at the end.
 Args    : A Bio::SeqFeature::Primer object (optional)
 Returns : A Bio::SeqFeature::Primer object

rev_primer

 Title   : rev_primer
 Usage   : my $primer = $feat->rev_primer();
 Function: Get or set the reverse primer. When setting it, the primary tag
          'rev_primer' is added to the primer.
 Args    : A Bio::SeqFeature::Primer object (optional)
 Returns : A Bio::SeqFeature::Primer object

LAST SEARCHED